Molecular Note
This allele was generated by electroporating Cas9 protein and 2 guide sequences GAGGGCACATGAGCAGGCCG and GCACACAGACTGTTAGCACG, which resulted in a 137 bp deletion beginning at Chromosome 14 position 54,545,708 bp and ending after 54,545,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124158 (exon 6) and 40 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 6 amino acids later.