Molecular Note
This allele was generated by injecting Cas9 RNA and 4 guide sequences CTATTGGGCCAGGAGGCTAG, GAGTTACTATTAAGTACACT, TGTTGCCTAATTGTGATTGG and TGAGTCTTACATATGGCAAT, which resulted in a 592 bp deletion beginning at Chromosome 1 positive strand position 10,047,149 bp and ending after 10,047,740 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001255443 (exon 3) and 489 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 5 amino acids later.