Molecular Note
This allele was generated by injecting Cas9 RNA and 4 guide sequences TGGGGACTGGATAAGTATGT, GATTATTCTCTTTGGAGCTG, TGCTTCACTTACCAACAGCA and GCAGTGTTTTGGTTTGTCAC, which resulted in a 391 bp deletion beginning at Chromosome 18 positive strand position 67,807,133 bp and ending after 67,807,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332162 (exon 5) and 242 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (T) intronic deletion 69 bp before the 391 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 97 and early truncation 4 amino acids later.
