Genetics
Allele Symbol
Ankrd26em1Ahol
Gene Name
ankyrin repeat domain 26
Strain of Origin
C57BL/6J
Molecular Note
CRISPR/cas9 genome editing uses two guide RNAs (gccacacatccagggtcgag and gaaagctgtggtattcacgc) and a single-stranded DNA to delete exons 23-30.
Husbandry
Suggested Controls
Wild-type from the colony
Breeding Considerations
When maintaining a live colony, heterozygous or homozygous mice may be bred together. Of note, the donating laboratory indicated that the homozygous matings yield smaller litters and reduced productivity beyond 16 weeks of age likely due to obesity phenotype.
Breeding Strategy
Heterozygote x Wild-type
Wild-type x Heterozygote